Rxivist logo

Rxivist combines preprints from bioRxiv with data from Twitter to help you find the papers being discussed in your field. Currently indexing 50,150 bioRxiv papers from 233,740 authors.

Most downloaded bioRxiv papers, all time

in category genomics

3,573 results found. For more information, click each entry to expand.

1: The Genomic Formation of South and Central Asia
more details view paper

Posted to bioRxiv 31 Mar 2018

The Genomic Formation of South and Central Asia
70,153 downloads genomics

Vagheesh M Narasimhan, Nick J Patterson, Priya Moorjani, Iosif Lazaridis, Lipson Mark, Swapan Mallick, Nadin Rohland, Rebecca Bernardos, Alexander M Kim, Nathan Nakatsuka, Inigo Olalde, Alfredo Coppa, James Mallory, Vyacheslav Moiseyev, Janet Monge, Luca M Olivieri, Nicole Adamski, Nasreen Broomandkhoshbacht, Francesca Candilio, Olivia Cheronet, Brendan J Culleton, Matthew Ferry, Daniel Fernandes, Beatriz Gamarra, Daniel Gaudio, Mateja Hajdinjak, Eadaoin Harney, Thomas K Harper, Denise Keating, Ann-Marie Lawson, Megan Michel, Mario Novak, Jonas Oppenheimer, Niraj Rai, Kendra Sirak, Viviane Slon, Kristin Stewardson, Zhao Zhang, Gaziz Akhatov, Anatoly N Bagashev, Baurzhan Baitanayev, Gian Luca Bonora, Tatiana Chikisheva, Anatoly Derevianko, Enshin Dmitry, Katerina Douka, Nadezhda Dubova, Andrey Epimakhov, Suzanne Freilich, Dorian Fuller, Alexander Goryachev, Andrey Gromov, Bryan Hanks, Margaret Judd, Erlan Kazizov, Aleksander Khokhlov, Egor Kitov, Elena Kupriyanova, Pavel Kuznetsov, Donata Luiselli, Farhad Maksudov, Chris Meiklejohn, Deborah C Merrett, Roberto Micheli, Oleg Mochalov, Zahir Muhammed, Samridin Mustafakulov, Ayushi Nayak, Rykun M Petrovna, Davide Pettner, Richard Potts, Dmitry Razhev, Stefania Sarno, Kulyan Sikhymbaevae, Sergey M Slepchenko, Nadezhda Stepanova, Svetlana Svyatko, Sergey Vasilyev, Massimo Vidale, Dima Voyakin, Antonina Yermolayeva, Alisa Zubova, Vasant S Shinde, Carles Lalueza-Fox, Matthias Meyer, David Anthony, Nicole Boivin, Kumarasmy Thangaraj, Douglas Kennett, Michael Frachetti, Ron Pinhasi, David Reich

The genetic formation of Central and South Asian populations has been unclear because of an absence of ancient DNA. To address this gap, we generated genome-wide data from 362 ancient individuals, including the first from eastern Iran, Turan (Uzbekistan, Turkmenistan, and Tajikistan), Bronze Age Kazakhstan, and South Asia. Our data reveal a complex set of genetic sources that ultimately combined to form the ancestry of South Asians today. We document a southward spread of genetic ancestry from the Eurasian Steppe, correlating with the archaeologically known expansion of pastoralist sites from the Steppe to Turan in the Middle Bronze Age (2300-1500 BCE). These Steppe communities mixed genetically with peoples of the Bactria Margiana Archaeological Complex (BMAC) whom they encountered in Turan (primarily descendants of earlier agriculturalists of Iran), but there is no evidence that the main BMAC population contributed genetically to later South Asians. Instead, Steppe communities integrated farther south throughout the 2nd millennium BCE, and we show that they mixed with a more southern population that we document at multiple sites as outlier individuals exhibiting a distinctive mixture of ancestry related to Iranian agriculturalists and South Asian hunter-gathers. We call this group Indus Periphery because they were found at sites in cultural contact with the Indus Valley Civilization (IVC) and along its northern fringe, and also because they were genetically similar to post-IVC groups in the Swat Valley of Pakistan. By co-analyzing ancient DNA and genomic data from diverse present-day South Asians, we show that Indus Periphery-related people are the single most important source of ancestry in South Asia — consistent with the idea that the Indus Periphery individuals are providing us with the first direct look at the ancestry of peoples of the IVC — and we develop a model for the formation of present-day South Asians in terms of the temporally and geographically proximate sources of Indus Periphery-related, Steppe, and local South Asian hunter-gatherer-related ancestry. Our results show how ancestry from the Steppe genetically linked Europe and South Asia in the Bronze Age, and identifies the populations that almost certainly were responsible for spreading Indo-European languages across much of Eurasia.

2: Patterns of genetic differentiation and the footprints of historical migrations in the Iberian Peninsula
more details view paper

Posted to bioRxiv 12 Mar 2018

Patterns of genetic differentiation and the footprints of historical migrations in the Iberian Peninsula
38,701 downloads genomics

Clare Bycroft, Ceres Fernández-Rozadilla, Clara Ruiz-Ponte, Iéns Quintela-García, Ángel Carracedo, Peter Donnelly, Simon Myers

Genetic differences within or between human populations (population structure) has been studied using a variety of approaches over many years. Recently there has been an increasing focus on studying genetic differentiation at fine geographic scales, such as within countries. Identifying such structure allows the study of recent population history, and identifies the potential for confounding in association studies, particularly when testing rare, often recently arisen variants. The Iberian Peninsula is linguistically diverse, has a complex demographic history, and is unique among European regions in having a centuries-long period of Muslim rule. Previous genetic studies of Spain have examined either a small fraction of the genome or only a few Spanish regions. Thus, the overall pattern of fine-scale population structure within Spain remains uncharacterised. Here we analyse genome-wide genotyping array data for 1,413 Spanish individuals sampled from all regions of Spain. We identify extensive fine-scale structure, down to unprecedented scales, smaller than 10 Km in some places. We observe a major axis of genetic differentiation that runs from east to west of the peninsula. In contrast, we observe remarkable genetic similarity in the north-south direction, and evidence of historical north-south population movement. Finally, without making particular prior assumptions about source populations, we show that modern Spanish people have regionally varying fractions of ancestry from a group most similar to modern north Moroccans. The north African ancestry results from an admixture event, which we date to 860 - 1120 CE, corresponding to the early half of Muslim rule. Our results indicate that it is possible to discern clear genetic impacts of the Muslim conquest and population movements associated with the subsequent Reconquista.

3: Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data
more details view paper

Posted to bioRxiv 04 Feb 2016

Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data
33,585 downloads genomics

Ran Blekhman, Karen Tang, Elizabeth Archie, Luis Barreiro, Zachary Johnson, Mark Wilson, Jordan Kohn, Michael Yuan, Laurence Gesquiere, Laura Grieneisen, Jenny Tung

Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples, which are often collected from known individuals and sometimes also sampled longitudinally across time. Such collections represent unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome, especially for species of particular conservation concern. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. This uncertainty arises in part because comparisons across storage methods to date generally include only a few (≤5) individuals, or analyze pooled samples. Here, we used n=52 samples from 13 rhesus macaque individuals to compare immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: storage in ethanol, lyophilization following ethanol storage, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts.

4: Creating a universal SNP and small indel variant caller with deep neural networks
more details view paper

Posted to bioRxiv 14 Dec 2016

Creating a universal SNP and small indel variant caller with deep neural networks
32,978 downloads genomics

Ryan Poplin, Pi-Chuan Chang, David Alexander, Scott Schwartz, Thomas Colthurst, Alexander Ku, Dan Newburger, Jojo Dijamco, Nam Nguyen, Pegah T. Afshar, Sam S. Gross, Lizzie Dorfman, Cory Y. McLean, Mark A. DePristo

Next-generation sequencing (NGS) is a rapidly evolving set of technologies that can be used to determine the sequence of an individual's genome by calling genetic variants present in an individual using billions of short, errorful sequence reads. Despite more than a decade of effort and thousands of dedicated researchers, the hand-crafted and parameterized statistical models used for variant calling still produce thousands of errors and missed variants in each genome. Here we show that a deep convolutional neural network can call genetic variation in aligned next-generation sequencing read data by learning statistical relationships (likelihoods) between images of read pileups around putative variant sites and ground-truth genotype calls. This approach, called DeepVariant, outperforms existing tools, even winning the "highest performance" award for SNPs in a FDA-administered variant calling challenge. The learned model generalizes across genome builds and even to other species, allowing non-human sequencing projects to benefit from the wealth of human ground truth data. We further show that, unlike existing tools which perform well on only a specific technology, DeepVariant can learn to call variants in a variety of sequencing technologies and experimental designs, from deep whole genomes from 10X Genomics to Ion Ampliseq exomes. DeepVariant represents a significant step from expert-driven statistical modeling towards more automatic deep learning approaches for developing software to interpret biological instrumentation data.

5: Analysis of protein-coding genetic variation in 60,706 humans
more details view paper

Posted to bioRxiv 30 Oct 2015

Analysis of protein-coding genetic variation in 60,706 humans
21,144 downloads genomics

Exome Aggregation Consortium, Monkol Lek, Konrad Karczewski, Eric Minikel, Kaitlin Samocha, Eric Banks, Timothy Fennell, Anne O'Donnell-Luria, James Ware, Andrew Hill, Beryl Cummings, Taru Tukiainen, Daniel Birnbaum, Jack Kosmicki, Laramie Duncan, Karol Estrada, Fengmei Zhao, James Zou, Emma Pierce-Hoffman, Joanne Berghout, David Cooper, Nicole Deflaux, Mark DePristo, Ron Do, Jason Flannick, Menachem Fromer, Laura Gauthier, Jackie Goldstein, Namrata Gupta, Daniel Howrigan, Adam Kiezun, Mitja Kurki, Ami Levy Moonshine, Pradeep Natarajan, Lorena Orozco, Gina Peloso, Ryan Poplin, Manuel Rivas, Valentin Ruano-Rubio, Samuel Rose, Douglas Ruderfer, Khalid Shakir, Peter Stenson, Christine Stevens, Brett Thomas, Grace Tiao, Maria Tusie-Luna, Ben Weisburd, Hong-Hee Won, Dongmei Yu, David Altshuler, Diego Ardissino, Michael Boehnke, John Danesh, Stacey Donnelly, Elosua Roberto, Jose Florez, Stacey Gabriel, Gad Getz, Stephen Glatt, Christina Hultman, Sekar Kathiresan, Markku Laakso, Steven McCarroll, Mark McCarthy, Dermot McGovern, Ruth McPherson, Benjamin Neale, Aarno Palotie, Shaun Purcell, Danish Saleheen, Jeremiah Scharf, Pamela Sklar, Patrick Sullivan, Jaakko Tuomilehto, Ming Tsuang, Hugh Watkins, James Wilson, Mark Daly, Daniel MacArthur

Large-scale reference data sets of human genetic variation are critical for the medical and functional interpretation of DNA sequence changes. Here we describe the aggregation and analysis of high-quality exome (protein-coding region) sequence data for 60,706 individuals of diverse ethnicities generated as part of the Exome Aggregation Consortium (ExAC). The resulting catalogue of human genetic diversity contains an average of one variant every eight bases of the exome, and provides direct evidence for the presence of widespread mutational recurrence. We show that this catalogue can be used to calculate objective metrics of pathogenicity for sequence variants, and to identify genes subject to strong selection against various classes of mutation; we identify 3,230 genes with near-complete depletion of truncating variants, 72% of which have no currently established human disease phenotype. Finally, we demonstrate that these data can be used for the efficient filtering of candidate disease-causing variants, and for the discovery of human knockout variants in protein-coding genes.

6: Complemented palindrome small RNAs first discovered from SARS coronavirus
more details view paper

Posted to bioRxiv 07 Sep 2017

Complemented palindrome small RNAs first discovered from SARS coronavirus
19,210 downloads genomics

Chang Liu, Ze Chen, Wenyuan Shen, Deshui Yu, Siyu Li, Yue Hu, Haishuo Ji, Wenjun Bu, Qingsong Wang, Shan Gao

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

7: Quantitative analysis of population-scale family trees using millions of relatives
more details view paper

Posted to bioRxiv 07 Feb 2017

Quantitative analysis of population-scale family trees using millions of relatives
18,122 downloads genomics

Joanna Kaplanis, Assaf Gordon, Mary Wahl, Michael Gershovits, Barak Markus, Mona Sheikh, Melissa Gymrek, Gaurav Bhatia, Daniel G. MacArthur, Alkes L. Price, Yaniv Erlich

Family trees have vast applications in multiple fields from genetics to anthropology and economics. However, the collection of extended family trees is tedious and usually relies on resources with limited geographical scope and complex data usage restrictions. Here, we collected 86 million profiles from publicly-available online data from genealogy enthusiasts. After extensive cleaning and validation, we obtained population-scale family trees, including a single pedigree of 13 million individuals. We leveraged the data to partition the genetic architecture of longevity by inspecting millions of relative pairs and to provide insights to population genetics theories on the dispersion of families. We also report a simple digital procedure to overlay other datasets with our resource in order to empower studies with population-scale genealogical data.

8: Comparative analysis of single-cell RNA sequencing methods
more details view paper

Posted to bioRxiv 05 Jan 2016

Comparative analysis of single-cell RNA sequencing methods
15,463 downloads genomics

Christoph Ziegenhain, Beate Vieth, Swati Parekh, Björn Reinius, Martha Smets, Heinrich Leonhardt, Ines Hellmann, Wolfgang Enard

Background: Single-cell RNA sequencing (scRNA‑seq) offers exciting possibilities to address biological and medical questions, but a systematic comparison of recently developed protocols is still lacking. Results: We generated data from 447 mouse embryonic stem cells using Drop‑seq, SCRB‑seq, Smart‑seq (on Fluidigm C1) and Smart‑seq2 and analyzed existing data from 35 mouse embryonic stem cells prepared with CEL‑seq. We find that Smart‑seq2 is the most sensitive method as it detects the most genes per cell and across cells. However, it shows more amplification noise than CEL‑seq, Drop‑seq and SCRB‑seq as it cannot use unique molecular identifiers (UMIs). We use simulations to model how the observed combinations of sensitivity and amplification noise affects detection of differentially expressed genes and find that SCRB‑seq reaches 80% power with the fewest number of cells. When considering cost-efficiency at different sequencing depths at 80% power, we find that Drop‑seq is preferable when quantifying transcriptomes of a large numbers of cells with low sequencing depth, SCRB‑seq is preferable when quantifying transcriptomes of fewer cells and Smart‑seq2 is preferable when annotating and/or quantifying transcriptomes of fewer cells as long one can use in-house produced transposase. Conclusions: Our analyses allows an informed choice among five prominent scRNA‑seq protocols and provides a solid framework for benchmarking future improvements in scRNA‑seq methodologies.

9: Mass-spectrometry of single mammalian cells quantifies proteome heterogeneity during cell differentiation
more details view paper

Posted to bioRxiv 24 Jan 2017

Mass-spectrometry of single mammalian cells quantifies proteome heterogeneity during cell differentiation
14,853 downloads genomics

Bogdan Budnik, Ezra Levy, Guillaume Harmange, Nikolai Slavov

Cellular heterogeneity is important to biological processes, including cancer and development. However, proteome heterogeneity is largely unexplored because of the limitations of existing methods for quantifying protein levels in single cells. To alleviate these limitations, we developed Single Cell ProtEomics by Mass Spectrometry (SCoPE-MS), and validated its ability to identify distinct human cancer cell types based on their proteomes. We used SCoPE-MS to quantify over a thousand proteins in differentiating mouse embryonic stem (ES) cells. The single-cell proteomes enabled us to deconstruct cell populations and infer protein abundance relationships. Comparison between single-cell proteomes and transcriptomes indicated coordinated mRNA and protein covariation. Yet many genes exhibited functionally concerted and distinct regulatory patterns at the mRNA and the protein levels, suggesting that post-transcriptional regulatory mechanisms contribute to proteome remodeling during lineage specification, especially for developmental genes. SCoPE-MS is broadly applicable to measuring proteome configurations of single cells and linking them to functional phenotypes, such as cell type and differentiation potentials.

10: Regulation of Life Span by the Gut Microbiota in The Short-Lived African Turquoise Killifish
more details view paper

Posted to bioRxiv 27 Mar 2017

Regulation of Life Span by the Gut Microbiota in The Short-Lived African Turquoise Killifish
14,645 downloads genomics

Patrick Smith, David Willemsen, Miriam Popkes, Franziska Metge, Edson Gandiwa, Martin Reichard, Dario Riccardo Valenzano

Gut bacteria occupy the interface between the organism and the external environment, contributing to homeostasis and disease. Yet, the causal role of the gut microbiota during host aging is largely unexplored. Here, using the African turquoise killifish (Nothobranchius furzeri), a naturally short-lived vertebrate, we show that the gut microbiota plays a key role in modulating vertebrate life span. Recolonizing the gut of middle-age individuals with bacteria from young donors resulted in life span extension and delayed behavioral decline. This intervention prevented the decrease in microbial diversity associated with host aging and maintained a young-like gut bacterial community, characterized by overrepresentation of the key genera Exiguobacterium, Planococcus, Propionigenium and Psychrobacter. Our findings demonstrate that the natural microbial gut community of young individuals can causally induce long-lasting beneficial systemic effects that lead to life span extension in a vertebrate model.

11: The Beaker Phenomenon And The Genomic Transformation Of Northwest Europe
more details view paper

Posted to bioRxiv 09 May 2017

The Beaker Phenomenon And The Genomic Transformation Of Northwest Europe
14,092 downloads genomics

Iñigo Olalde, Selina Brace, Morten E. Allentoft, Ian Armit, Kristian Kristiansen, Nadin Rohland, Swapan Mallick, Thomas Booth, Anna Szécsényi-Nagy, Alissa Mittnik, Eveline Altena, Mark Lipson, Iosif Lazaridis, Nick Patterson, Nasreen Broomandkhoshbacht, Yoan Diekmann, Zuzana Faltyskova, Daniel Fernandes, Matthew Ferry, Eadaoin Harney, Peter de Knijff, Megan Michel, Jonas Oppenheimer, Kristin Stewardson, Alistair Barclay, Kurt W. Alt, Azucena Avilés Fernández, Eszter Bánffy, Maria Bernabò-Brea, David Billoin, Concepción Blasco, Clive Bonsall, Laura Bonsall, Tim Allen, Lindsey Büster, Sophie Carver, Laura Castells Navarro, Oliver Edward Craig, Gordon T. Cook, Barry Cunliffe, Anthony Denaire, Kirsten Egging Dinwiddy, Natasha Dodwell, Michal Ernée, Christopher Evans, Milan Kuchařík, Joan Francès Farré, Harry Fokkens, Chris Fowler, Michiel Gazenbeek, Rafael Garrido Pena, María Haber-Uriarte, Elżbieta Haduch, Gill Hey, Nick Jowett, Timothy Knowles, Ken Massy, Saskia Pfrengle, Philippe Lefranc, Olivier Lemercier, Arnaud Lefebvre, Joaquín Lomba Maurandi, Tona Majó, Jacqueline I. McKinley, Kathleen McSweeney, Mende Balázs Gusztáv, Alessandra Modi, Gabriella Kulcsár, Viktória Kiss, András Czene, Róbert Patay, Anna Endrődi, Kitti Köhler, Tamás Hajdu, João Luís Cardoso, Corina Liesau, Michael Parker Pearson, Piotr Włodarczak, T. Douglas Price, Pilar Prieto, Pierre-Jérôme Rey, Patricia Ríos, Roberto Risch, Manuel A. Rojo Guerra, Aurore Schmitt, Joël Serralongue, Ana Maria Silva, Václav Smrčka, Luc Vergnaud, João Zilhão, David Caramelli, Thomas Higham, Volker Heyd, Alison Sheridan, Karl-Göran Sjögren, Mark G. Thomas, Philipp W. Stockhammer, Ron Pinhasi, Johannes Krause, Wolfgang Haak, Ian Barnes, Carles Lalueza-Fox, David Reich

Bell Beaker pottery spread across western and central Europe beginning around 2750 BCE before disappearing between 2200-1800 BCE. The mechanism of its expansion is a topic of long-standing debate, with support for both cultural diffusion and human migration. We present new genome-wide ancient DNA data from 170 Neolithic, Copper Age and Bronze Age Europeans, including 100 Beaker-associated individuals. In contrast to the Corded Ware Complex, which has previously been identified as arriving in central Europe following migration from the east, we observe limited genetic affinity between Iberian and central European Beaker Complex-associated individuals, and thus exclude migration as a significant mechanism of spread between these two regions. However, human migration did have an important role in the further dissemination of the Beaker Complex, which we document most clearly in Britain using data from 80 newly reported individuals dating to 3900-1200 BCE. British Neolithic farmers were genetically similar to contemporary populations in continental Europe and in particular to Neolithic Iberians, suggesting that a portion of the farmer ancestry in Britain came from the Mediterranean rather than the Danubian route of farming expansion. Beginning with the Beaker period, and continuing through the Bronze Age, all British individuals harboured high proportions of Steppe ancestry and were genetically closely related to Beaker-associated individuals from the Lower Rhine area. We use these observations to show that the spread of the Beaker Complex to Britain was mediated by migration from the continent that replaced >90% of Britain's Neolithic gene pool within a few hundred years, continuing the process that brought Steppe ancestry into central and northern Europe 400 years earlier.

12: Vibrio natriegens, a new genomic powerhouse
more details view paper

Posted to bioRxiv 12 Jun 2016

Vibrio natriegens, a new genomic powerhouse
14,057 downloads genomics

Henry H Lee, Nili Ostrov, Brandon G Wong, Michaela A Gold, Ahmad Khalil, George M Church

Recombinant DNA technology has revolutionized biomedical research with continual innovations advancing the speed and throughput of molecular biology. Nearly all these tools, however, are reliant on Escherichia coli as a host organism, and its lengthy growth rate increasingly dominates experimental time. Here we report the development of Vibrio natriegens, a free-living bacteria with the fastest generation time known, into a genetically tractable host organism. We systematically characterize its growth properties to establish basic laboratory culturing conditions. We provide the first complete Vibrio natriegens genome, consisting of two chromosomes of 3,248,023 bp and 1,927,310 bp that together encode 4,578 open reading frames. We reveal genetic tools and techniques for working with Vibrio natriegens. These foundational resources will usher in an era of advanced genomics to accelerate biological, biotechnological, and medical discoveries.

13: Highly parallel direct RNA sequencing on an array of nanopores
more details view paper

Posted to bioRxiv 12 Aug 2016

Highly parallel direct RNA sequencing on an array of nanopores
13,797 downloads genomics

Daniel R Garalde, Elizabeth A Snell, Daniel Jachimowicz, Andrew J Heron, Mark Bruce, Joseph Lloyd, Anthony Warland, Nadia Pantic, Tigist Admassu, Jonah Ciccone, Sabrina Serra, Jemma Keenan, Samuel Martin, Luke McNeill, Jayne Wallace, Lakmal Jayasinghe, Chris Wright, Javier Blasco, Botond Sipos, Stephen Young, Sissel Juul, James Clarke, Daniel J Turner

Ribonucleic acid sequencing can allow us to monitor the RNAs present in a sample. This enables us to detect the presence and nucleotide sequence of viruses, or to build a picture of how active transcriptional processes are changing -- information that is useful for understanding the status and function of a sample. Nanopore-based sequencing technology is capable of electronically analysing a sample's DNA directly, and in real-time. In this manuscript we demonstrate the ability of an array of nanopores to sequence RNA directly, and we apply it to a range of biological situations. Nanopore technology is the only available sequencing technology which can sequence RNA directly, rather than depending on reverse transcription and PCR. There are several potential advantages of this approach over other RNA-seq strategies, including the absence of amplification and reverse transcription biases, the ability to detect nucleotide analogues and the ability to generate full-length, strand-specific RNA sequences. This will improve the ease and speed of RNA analysis, while yielding richer biological information.

14: Comprehensive integration of single cell data
more details view paper

Posted to bioRxiv 02 Nov 2018

Comprehensive integration of single cell data
13,715 downloads genomics

Tim Stuart, Andrew Butler, Paul Hoffman, Christoph Hafemeister, Efthymia Papalexi, William M. Mauck, Marlon Stoeckius, Peter Smibert, Rahul Satija

Single cell transcriptomics (scRNA-seq) has transformed our ability to discover and annotate cell types and states, but deep biological understanding requires more than a taxonomic listing of clusters. As new methods arise to measure distinct cellular modalities, including high-dimensional immunophenotypes, chromatin accessibility, and spatial positioning, a key analytical challenge is to integrate these datasets into a harmonized atlas that can be used to better understand cellular identity and function. Here, we develop a computational strategy to "anchor" diverse datasets together, enabling us to integrate and compare single cell measurements not only across scRNA-seq technologies, but different modalities as well. After demonstrating substantial improvement over existing methods for data integration, we anchor scRNA-seq experiments with scATAC-seq datasets to explore chromatin differences in closely related interneuron subsets, and project single cell protein measurements onto a human bone marrow atlas to annotate and characterize lymphocyte populations. Lastly, we demonstrate how anchoring can harmonize in-situ gene expression and scRNA-seq datasets, allowing for the transcriptome-wide imputation of spatial gene expression patterns, and the identification of spatial relationships between mapped cell types in the visual cortex. Our work presents a strategy for comprehensive integration of single cell data, including the assembly of harmonized references, and the transfer of information across datasets. Availability: Installation instructions, documentation, and tutorials are available at: https://www.satijalab.org/seurat

15: RNA velocity in single cells
more details view paper

Posted to bioRxiv 19 Oct 2017

RNA velocity in single cells
12,746 downloads genomics

Gioele La Manno, Ruslan Soldatov, Hannah Hochgerner, Amit Zeisel, Viktor Petukhov, Maria Kastriti, Peter Lonnerberg, Alessandro Furlan, Jean Fan, Zehua Liu, David van Bruggen, Jimin Guo, Erik Sundstrom, Goncalo Castelo-Branco, Igor Adameyko, Sten Linnarsson, Peter Kharchenko

RNA abundance is a powerful indicator of the state of individual cells, but does not directly reveal dynamic processes such as cellular differentiation. Here we show that RNA velocity - the time derivative of RNA abundance - can be estimated by distinguishing unspliced and spliced mRNAs in standard single-cell RNA sequencing protocols. We show that RNA velocity is a vector that predicts the future state of individual cells on a timescale of hours. We validate the accuracy of RNA velocity in the neural crest lineage, demonstrate its use on multiple technical platforms, reconstruct the branching lineage tree of the mouse hippocampus, and measure RNA kinetics in human embryonic brain. We expect RNA velocity to greatly aid the analysis of developmental lineages and cellular dynamics, particularly in humans.

16: Nanopore sequencing and assembly of a human genome with ultra-long reads
more details view paper

Posted to bioRxiv 20 Apr 2017

Nanopore sequencing and assembly of a human genome with ultra-long reads
12,680 downloads genomics

Miten Jain, Sergey Koren, Josh Quick, Arthur C Rand, Thomas A. Sasani, John R Tyson, Andrew D Beggs, Alexander T Dilthey, Ian T. Fiddes, Sunir Malla, Hannah Marriott, Karen H Miga, Tom Nieto, Justin O'Grady, Hugh E Olsen, Brent S Pedersen, Arang Rhie, Hollian Richardson, Aaron Quinlan, Terrance P Snutch, Louise Tee, Benedict Paten, Adam M Phillippy, Jared T Simpson, Nicholas James Loman, Matthew Loose

Nanopore sequencing is a promising technique for genome sequencing due to its portability, ability to sequence long reads from single molecules, and to simultaneously assay DNA methylation. However until recently nanopore sequencing has been mainly applied to small genomes, due to the limited output attainable. We present nanopore sequencing and assembly of the GM12878 Utah/Ceph human reference genome generated using the Oxford Nanopore MinION and R9.4 version chemistry. We generated 91.2 Gb of sequence data (~30x theoretical coverage) from 39 flowcells. De novo assembly yielded a highly complete and contiguous assembly (NG50 ~3Mb). We observed considerable variability in homopolymeric tract resolution between different basecallers. The data permitted sensitive detection of both large structural variants and epigenetic modifications. Further we developed a new approach exploiting the long-read capability of this system and found that adding an additional 5x-coverage of "ultra-long" reads (read N50 of 99.7kb) more than doubled the assembly contiguity. Modelling the repeat structure of the human genome predicts extraordinarily contiguous assemblies may be possible using nanopore reads alone. Portable de novo sequencing of human genomes may be important for rapid point-of-care diagnosis of rare genetic diseases and cancer, and monitoring of cancer progression. The complete dataset including raw signal is available as an Amazon Web Services Open Dataset at: https://github.com/nanopore-wgs-consortium/NA12878.

17: An Atlas of Genetic Correlations across Human Diseases and Traits
more details view paper

Posted to bioRxiv 27 Jan 2015

An Atlas of Genetic Correlations across Human Diseases and Traits
12,569 downloads genomics

Brendan Bulik-Sullivan, Hilary K Finucane, Verneri Anttila, Alexander Gusev, Felix R Day, ReproGen Consortium, Psychiatric Genomics Consortium, Anorexia Nervosa Genetic Consortium Wellcome Trust Consortium 3, Laramie Duncan, John RB Perry, Nick Patterson, Elise Robinson, Mark J. Daly, Alkes L. Price, Benjamin M Neale

Identifying genetic correlations between complex traits and diseases can provide useful etiological insights and help prioritize likely causal relationships. The major challenges preventing estimation of genetic correlation from genome-wide association study (GWAS) data with current methods are the lack of availability of individual genotype data and widespread sample overlap among meta-analyses. We circumvent these difficulties by introducing a technique for estimating genetic correlation that requires only GWAS summary statistics and is not biased by sample overlap. We use our method to estimate 300 genetic correlations among 25 traits, totaling more than 1.5 million unique phenotype measurements. Our results include genetic correlations between anorexia nervosa and schizophrenia/ body mass index and associations between educational attainment and several diseases. These results highlight the power of a polygenic modeling framework, since there currently are no genome-wide significant SNPs for anorexia nervosa and only three for educational attainment.

18: Integrated analysis of single cell transcriptomic data across conditions, technologies, and species
more details view paper

Posted to bioRxiv 18 Jul 2017

Integrated analysis of single cell transcriptomic data across conditions, technologies, and species
11,774 downloads genomics

Andrew Butler, Rahul Satija

Single cell RNA-seq (scRNA-seq) has emerged as a transformative tool to discover and define cellular phenotypes. While computational scRNA-seq methods are currently well suited for experiments representing a single condition, technology, or species, analyzing multiple datasets simultaneously raises new challenges. In particular, traditional analytical workflows struggle to align subpopulations that are present across datasets, limiting the possibility for integrated or comparative analysis. Here, we introduce a new computational strategy for scRNA-seq alignment, utilizing common sources of variation to identify shared subpopulations between datasets as part of our R toolkit Seurat. We demonstrate our approach by aligning scRNA-seq datasets of PBMCs under resting and stimulated conditions, hematopoietic progenitors sequenced across two profiling technologies, and pancreatic cell 'atlases' generated from human and mouse islets. In each case, we learn distinct or transitional cell states jointly across datasets, and can identify subpopulations that could not be detected by analyzing datasets independently. We anticipate that these methods will serve not only to correct for batch or technology-dependent effects, but also to facilitate general comparisons of scRNA-seq datasets, potentially deepening our understanding of how distinct cell states respond to perturbation, disease, and evolution. Availability: Installation instructions, documentation, and tutorials are available at http://www.satijalab.org/seurat

19: When to use Quantile Normalization?
more details view paper

Posted to bioRxiv 04 Dec 2014

When to use Quantile Normalization?
11,519 downloads genomics

Stephanie C Hicks, Rafael A. Irizarry

Normalization and preprocessing are essential steps for the analysis of high-throughput data including next-generation sequencing and microarrays. Multi-sample global normalization methods, such as quantile normalization, have been successfully used to remove technical variation from noisy data. These methods rely on the assumption that observed global changes across samples are due to unwanted technical variability. Transforming the data to remove these differences has the potential to remove interesting biologically driven global variation and therefore may not be appropriate depending on the type and source of variation. Currently, it is up to the subject matter experts, for example biologists, to determine if the stated assumptions are appropriate or not. Here, we propose a data-driven method to test for the assumptions of global normalization methods. We demonstrate the utility of our method (quantro), by applying it to multiple gene expression and DNA methylation and show examples of when global normalization methods are not appropriate. We also perform a Monte Carlo simulation study to illustrate how our method generally outperforms the current approach. An R-package implementing our method is available on Bioconductor (http://www.bioconductor.org/packages/release/bioc/html/quantro.html).

20: Scaling single cell transcriptomics through split pool barcoding
more details view paper

Posted to bioRxiv 02 Feb 2017

Scaling single cell transcriptomics through split pool barcoding
11,503 downloads genomics

Alexander B Rosenberg, Charles Roco, Richard A. Muscat, Anna Kuchina, Sumit Mukherjee, Wei Chen, David J Peeler, Zizhen Yao, Bosiljka Tasic, Drew L Sellers, Suzie H Pun, Georg Seelig

Constructing an atlas of cell types in complex organisms will require a collective effort to characterize billions of individual cells. Single cell RNA sequencing (scRNA-seq) has emerged as the main tool for characterizing cellular diversity, but current methods use custom microfluidics or microwells to compartmentalize single cells, limiting scalability and widespread adoption. Here we present Split Pool Ligation-based Transcriptome sequencing (SPLiT-seq), a scRNA-seq method that labels the cellular origin of RNA through combinatorial indexing. SPLiT-seq is compatible with fixed cells, scales exponentially, uses only basic laboratory equipment, and costs one cent per cell. We used this approach to analyze 109,069 single cell transcriptomes from an entire postnatal day 5 mouse brain, providing the first global snapshot at this stage of development. We identified 13 main populations comprising different types of neurons, glia, immune cells, endothelia, as well as types in the blood-brain-barrier. Moreover, we resolve substructure within these clusters corresponding to cells at different stages of development. As sequencing capacity increases, SPLiT-seq will enable profiling of billions of cells in a single experiment.

Previous page 1 2 3 4 5 . . . 179 Next page

Sign up for the Rxivist weekly newsletter! (Click here for more details.)


News